Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MurR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type: Transcription factor
TF locus tag: L147291
Regulator family: RpiR
Regulation mode: repressor
Biological process: N-acetylmuramate utilization
Effector: N-acetylmuramate-6-phosphate
Regulog: MurR - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -112
Score: 6.4
Sequence: CAATGAAATAATATTTCAAAA
Position: -71
Score: 6.8
Sequence: ACTTGAAATAATAATTCTTTT
Locus tag: L143292
Name: murX
Funciton: Predicted outer membrane protein
Locus tag: L144334
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: L145238
Name: murP
Funciton: MurNAc-specific PTS system, EIIBC component
Locus tag: L146642
Name: murP
Funciton: MurNAc-specific PTS system, EIIBC component
Locus tag: L147291
Name: murR
Funciton: N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
murX
Predicted outer membrane protein
murQ
N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
murP
MurNAc-specific PTS system, EIIBC component
murP
MurNAc-specific PTS system, EIIBC component
murR
N-acetylmuramate utilization transcriptional regulator MurR, RpiR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD