Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Cg1831 in Corynebacterium efficiens YS-314

Properties
Regulator type: Transcription factor
TF locus tag: CE2678
Regulator family: ArsR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector:
Regulog: Cg1831 - Corynebacteriaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: 8
Score: 5.9
Sequence: ACTCAATCACCCGTTTGACT
Locus tag: CE2678
Name: cg1831
Funciton: Predicted Fe-siderophore transport transcriptional regulator, MerR family
cg1831
Predicted Fe-siderophore transport transcriptional regulator, MerR family

Position: -34
Score: 5.9
Sequence: AGTCAAACGGGTGATTGAGT
Locus tag: CE2677
Name: cg1832
Funciton: Predicted Fe-siderophore ABC transporter, permease protein
Locus tag: CE2676
Name: cg1833
Funciton: Predicted Fe-siderophore ABC transporter, substrate-binding protein
Locus tag: CE2675
Name: cg1834
Funciton: Predicted Fe-siderophore ABC transporter, ATP-binding protein
cg1832
Predicted Fe-siderophore ABC transporter, permease protein
cg1833
Predicted Fe-siderophore ABC transporter, substrate-binding protein
cg1834
Predicted Fe-siderophore ABC transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD