Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CitB in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type: Transcription factor
TF locus tag: cg0090
Regulator family: CitB
Regulation mode: activator
Biological process: Citrate utilization
Effector: Citrate
Regulog: CitB - Corynebacteriaceae
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -148
Score: 5.7
Sequence: GATCATAATGCACAAAAGTC
Locus tag: cg0088
Name: citH
Funciton: Citrate transporter
citH
Citrate transporter

Position: -80
Score: 5.2
Sequence: GACTTTTGTGCATTATGATC
Locus tag: cg0089
Name: citA
Funciton: Citrate transport regulation two-component system histidine kinase
Locus tag: cg0090
Name: citB
Funciton: Citrate transport regulation two-component system response regulator, LuxR family
citA
Citrate transport regulation two-component system histidine kinase
citB
Citrate transport regulation two-component system response regulator, LuxR family

Position: -43
Score: 5.1
Sequence: GAGCTTGTTGTCCAAAAGTC
Locus tag: cg3127
Name: tctC
Funciton: Citrate TTT family transporter, subunit C
Locus tag: cg3126
Name: tctB
Funciton: Citrate TTT family transporter, subunit B
Locus tag: cg3125
Name: tctA
Funciton: Citrate TTT family transporter, subunit A
tctC
Citrate TTT family transporter, subunit C
tctB
Citrate TTT family transporter, subunit B
tctA
Citrate TTT family transporter, subunit A
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD