Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CitB in Corynebacterium efficiens YS-314

Properties
Regulator type: Transcription factor
TF locus tag: CE2904
Regulator family: CitB
Regulation mode: activator
Biological process: Citrate utilization
Effector: Citrate
Regulog: CitB - Corynebacteriaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -35
Score: 6
Sequence: GAACTAAATGCACTTAATTC
Locus tag: CE2906
Name: citH
Funciton: Citrate transporter
citH
Citrate transporter

Position: -81
Score: 5.8
Sequence: GAATTAAGTGCATTTAGTTC
Locus tag: CE2905
Name: citA
Funciton: Citrate transport regulation two-component system histidine kinase
Locus tag: CE2904
Name: citB
Funciton: Citrate transport regulation two-component system response regulator, LuxR family
citA
Citrate transport regulation two-component system histidine kinase
citB
Citrate transport regulation two-component system response regulator, LuxR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD