Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Streptococcus suis 05ZYH33

Properties
Regulator type: Transcription factor
TF locus tag: SSU05_2087
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -135
Score: 5.4
Sequence: ATAAATAACTTGACTTTCTTTT
Position: -103
Score: 5.3
Sequence: ATAATTAACTTAGTTAAATGAT
Locus tag: SSU05_0309
Name: SPy1434
Funciton: Predicted cation transporting ATPase (EC 3.6.3.3)
SPy1434
Predicted cation transporting ATPase (EC 3.6.3.3)

Position: -32
Score: 5.1
Sequence: TAAATTAATTAAACTTAAAAAA
Locus tag: SSU05_1982
Name: prtA
Funciton: C5a peptidase precursor (EC 3.4.21.-)
prtA
C5a peptidase precursor (EC 3.4.21.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD