Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Streptococcus pneumoniae TIGR4

Properties
Regulator type: Transcription factor
TF locus tag: SP_1638
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -194
Score: 5.8
Sequence: TAAATTAACTAATGTTAATTTT
Locus tag: SP_0641
Name: prtA
Funciton: C5a peptidase precursor (EC 3.4.21.-)
prtA
C5a peptidase precursor (EC 3.4.21.-)

Position: -62
Score: 6.4
Sequence: AAAATTAACTTGACTTAATTTT
Locus tag: SP_1648
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: SP_1649
Name: mntC
Funciton: Manganese ABC transporter, permease protein
Locus tag: SP_1650
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, permease protein
mntA
Manganese ABC transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD