Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Streptococcus mitis B6

Properties
Regulator type: Transcription factor
TF locus tag: smi_0645
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -164
Score: 5.2
Sequence: AAAATTAACCAATATTAATAAT
Locus tag: smi_1232
Name: mntH
Funciton: Manganese transport protein MntH
mntH
Manganese transport protein MntH

Position: -194
Score: 5.6
Sequence: AAAATTAACCAGCCTTAATTTT
Locus tag: smi_0705
Name: prtA
Funciton: C5a peptidase precursor (EC 3.4.21.-)
prtA
C5a peptidase precursor (EC 3.4.21.-)

Position: -62
Score: 6.1
Sequence: AAAATTAACTTGACTTAACTTT
Locus tag: smi_0636
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: smi_0635
Name: mntC
Funciton: Manganese ABC transporter, permease protein
Locus tag: smi_0634
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, permease protein
mntA
Manganese ABC transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD