Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type: Transcription factor
TF locus tag: Sez_1470
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -116
Score: 6.2
Sequence: TTAATTAAGTATAGTTAATTAT
Locus tag: Sez_1470
Name: mntR
Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
mntR
Manganese homeostasis transcriptional regulator MntR, DtxR family

Position: -51
Score: 6.4
Sequence: ATAATTAACTATACTTAATTAA
Locus tag: Sez_1469
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: Sez_1468
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Sez_1467
Name: mntC
Funciton: Manganese ABC transporter, permease protein
mntA
Manganese ABC transporter, substrate-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, permease protein

Position: -79
Score: 5.9
Sequence: TAAATTAACCATACTTAATTTT
Locus tag: Sez_1456
Name: nikA
Funciton: Nickel ABC transporter, substrate-binding protein
Locus tag: Sez_1455
Name: nikB
Funciton: Nickel ABC transporter, permease protein 1
Locus tag: Sez_1454
Name: nikC
Funciton: Nickel ABC transporter, permease protein 2
Locus tag: Sez_1453
Name: nikD
Funciton: Nickel ABC transporter, ATP-binding protein 1
Locus tag: Sez_1452
Name: nikE
Funciton: Nickel ABC transporter, ATP-binding protein 2
nikA
Nickel ABC transporter, substrate-binding protein
nikB
Nickel ABC transporter, permease protein 1
nikC
Nickel ABC transporter, permease protein 2
nikD
Nickel ABC transporter, ATP-binding protein 1
nikE
Nickel ABC transporter, ATP-binding protein 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD