Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type: Transcription factor
TF locus tag: SDEG_0487
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 5
Sequence: ATAATTAATATATCTTAAAGAT
Locus tag: SDEG_1473
Name: SPy1434
Funciton: Predicted cation transporting ATPase (EC 3.6.3.3)
SPy1434
Predicted cation transporting ATPase (EC 3.6.3.3)

Position: -116
Score: 6
Sequence: TTAATTAAGTATAGTTAAATAT
Locus tag: SDEG_0487
Name: mntR
Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
mntR
Manganese homeostasis transcriptional regulator MntR, DtxR family

Position: -51
Score: 6.1
Sequence: ATATTTAACTATACTTAATTAA
Locus tag: SDEG_0488
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: SDEG_0489
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: SDEG_0490
Name: mntC
Funciton: Manganese ABC transporter, permease protein
mntA
Manganese ABC transporter, substrate-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD