Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type: Transcription factor
TF locus tag: L84767
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -87
Score: 4.9
Sequence: CAAAATATATTGATTTAATTTT
Locus tag: L150744
Name: mntB
Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: L149891
Name: mntC
Funciton: Manganese ABC transporter, permease protein
Locus tag: L148957
Name: mntA
Funciton: Manganese ABC transporter, substrate-binding protein
mntB
Manganese ABC transporter, ATP-binding protein
mntC
Manganese ABC transporter, permease protein
mntA
Manganese ABC transporter, substrate-binding protein

Position: -31
Score: 5.1
Sequence: ATAATTAAATCAAGAAAAGTAA
Locus tag: L84767
Name: mntR
Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
mntR
Manganese homeostasis transcriptional regulator MntR, DtxR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD