Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type: Transcription factor
TF locus tag: LACR_1369
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Streptococcaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -31
Score: 5.1
Sequence: ATAATTAAATGGAGAAAAGTAA
Locus tag: LACR_1369
Name: mntR
Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
mntR
Manganese homeostasis transcriptional regulator MntR, DtxR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD