Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XapR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type: Transcription factor
TF locus tag: b2405
Regulator family: LysR
Regulation mode: activator
Biological process: Xanthosine utilization
Effector: Deoxyinosine; Xanthosine
Regulog: XapR - Enterobacteriales
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -132
Score: 4.2
Sequence: TTAATAGAGAAAAGATATAAA
Position: -107
Score: 5.9
Sequence: TCGATATCGAATCGCTATTGA
Locus tag: b2407
Name: xapA
Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: b2406
Name: xapB
Funciton: Xanthosine permease
xapA
Xanthosine phosphorylase (EC 2.4.2.1)
xapB
Xanthosine permease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD