Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of XapR in Edwardsiella tarda EIB202

Properties
Regulator type: Transcription factor
TF locus tag: ETAE_2781
Regulator family: LysR
Regulation mode: activator
Biological process: Xanthosine utilization
Effector: Deoxyinosine; Xanthosine
Regulog: XapR - Enterobacteriales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -115
Score: 4.4
Sequence: TCCCTAGCAAATCAATACTGA
Locus tag: ETAE_2779
Name: xapA
Funciton: Xanthosine phosphorylase (EC 2.4.2.1)
Locus tag: ETAE_2780
Name: xapX
Funciton: Predicted xanthosine transporter
Locus tag: ETAE_2781
Name: xapR
Funciton: Xanthosine operon regulatory protein XapR, LysR family
xapA
Xanthosine phosphorylase (EC 2.4.2.1)
xapX
Predicted xanthosine transporter
xapR
Xanthosine operon regulatory protein XapR, LysR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD