Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SPy1285 in Streptococcus thermophilus CNRZ1066

Properties
Regulator type: Transcription factor
TF locus tag: str1435
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Transport
Effector:
Regulog: SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -59
Score: 6.3
Sequence: TTGTATCATTACTTTAGTACAA
Locus tag: str1435
Name: SPy1285
Funciton: Predicted transcriptional regulator, GntR family
Locus tag: str1436
Name: SPy1286
Funciton: Predicted ABC transporter, ATP-binding protein 1
Locus tag: str1437
Name: SPy1287
Funciton: Predicted ABC transporter, ATP-binding protein 2
SPy1285
Predicted transcriptional regulator, GntR family
SPy1286
Predicted ABC transporter, ATP-binding protein 1
SPy1287
Predicted ABC transporter, ATP-binding protein 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD