Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SPy1285 in Streptococcus suis 05ZYH33

Properties
Regulator type: Transcription factor
TF locus tag: SSU05_0541
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Transport
Effector:
Regulog: SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes 10
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -124
Score: 5
Sequence: TTGTACTAATTCAGCAGTATAA
Locus tag: SSU05_0748
Name: SAG0280
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: SSU05_0747
Name: SAG0281
Funciton: ABC transporter permease protein
SAG0280
ABC-type multidrug transport system, ATPase component
SAG0281
ABC transporter permease protein

Position: -48
Score: 5.9
Sequence: TTGTATTATTAAGATAAGACAT
Locus tag: SSU05_0541
Name: SPy1285
Funciton: Predicted transcriptional regulator, GntR family
Locus tag: SSU05_0540
Name: SPy1286
Funciton: Predicted ABC transporter, ATP-binding protein 1
Locus tag: SSU05_0539
Name: SPy1287
Funciton: Predicted ABC transporter, ATP-binding protein 2
SPy1285
Predicted transcriptional regulator, GntR family
SPy1286
Predicted ABC transporter, ATP-binding protein 1
SPy1287
Predicted ABC transporter, ATP-binding protein 2

Position: -28
Score: 5.9
Sequence: GTGTATTATATAGACAACACAA
Locus tag: SSU05_0513
Name: SPy0836
Funciton: Predicted ABC transporter, periplasmic protein
Locus tag: SSU05_0514
Name: SPy0837
Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: SSU05_0515
Name: SPy0837
Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: SSU05_0516
Name: SPy0838
Funciton: Predicted ABC transporter, permease protein
Locus tag: SSU05_0517
Name: SPy0838
Funciton: Predicted ABC transporter, permease protein
SPy0836
Predicted ABC transporter, periplasmic protein
SPy0837
Predicted ABC transporter, ATP-binding protein
SPy0837
Predicted ABC transporter, ATP-binding protein
SPy0838
Predicted ABC transporter, permease protein
SPy0838
Predicted ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD