Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SPy1285 in Streptococcus mitis B6

Properties
Regulator type: Transcription factor
TF locus tag: smi_0581
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Transport
Effector:
Regulog: SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -153
Score: 6.5
Sequence: GTGTATTATATATCTAGTACAA
Locus tag: smi_0839
Name: SPy0836
Funciton: Predicted ABC transporter, periplasmic protein
Locus tag: smi_0840
Name: SPy0837
Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: smi_0841
Name: SPy0838
Funciton: Predicted ABC transporter, permease protein
SPy0836
Predicted ABC transporter, periplasmic protein
SPy0837
Predicted ABC transporter, ATP-binding protein
SPy0838
Predicted ABC transporter, permease protein

Position: -46
Score: 6.7
Sequence: TTGTATTATTTAATTAAGACAA
Locus tag: smi_0581
Name: SPy1285
Funciton: Predicted transcriptional regulator, GntR family
Locus tag: smi_0580
Name: SPy1286
Funciton: Predicted ABC transporter, ATP-binding protein 1
Locus tag: smi_0579
Name: SPy1287
Funciton: Predicted ABC transporter, ATP-binding protein 2
SPy1285
Predicted transcriptional regulator, GntR family
SPy1286
Predicted ABC transporter, ATP-binding protein 1
SPy1287
Predicted ABC transporter, ATP-binding protein 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD