Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SPy1285 in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type: Transcription factor
TF locus tag: SDEG_1097
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Transport
Effector:
Regulog: SPy1285 - Streptococcaceae
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -51
Score: 6.4
Sequence: CTGTACCATTTATTTAGTACAA
Locus tag: SDEG_1097
Name: SPy1285
Funciton: Predicted transcriptional regulator, GntR family
Locus tag: SDEG_1098
Name: SPy1286
Funciton: Predicted ABC transporter, ATP-binding protein 1
Locus tag: SDEG_1099
Name: SPy1287
Funciton: Predicted ABC transporter, ATP-binding protein 2
SPy1285
Predicted transcriptional regulator, GntR family
SPy1286
Predicted ABC transporter, ATP-binding protein 1
SPy1287
Predicted ABC transporter, ATP-binding protein 2

Position: -39
Score: 5.1
Sequence: TTGTATTAGCGTAAAAGTACAA
Locus tag: SDEG_1734
Name: SAG0279
Funciton: hypothetical protein
Locus tag: SDEG_1733
Name: SAG0280
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: SDEG_1732
Name: SAG0281
Funciton: ABC transporter permease protein
SAG0279
hypothetical protein
SAG0280
ABC-type multidrug transport system, ATPase component
SAG0281
ABC transporter permease protein

Position: -37
Score: 6.6
Sequence: TTGTCTTATAAAAATAGTACAA
Locus tag: SDEG_0798
Name: SPy0836
Funciton: Predicted ABC transporter, periplasmic protein
Locus tag: SDEG_0799
Name: SPy0837
Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: SDEG_0800
Name: SPy0838
Funciton: Predicted ABC transporter, permease protein
SPy0836
Predicted ABC transporter, periplasmic protein
SPy0837
Predicted ABC transporter, ATP-binding protein
SPy0838
Predicted ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD