Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YjdR in Streptococcus uberis 0140J

Properties
Regulator type: Transcription factor
TF locus tag: SUB1690
Regulator family: MarR
Regulation mode:
Biological process: Multidrug resistance
Effector:
Regulog: YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -51
Score: 6.5
Sequence: ATAGTTCTCTTAAGAACTAA
Position: -30
Score: 5.9
Sequence: ATGGTTTTCACGAGAACTAA
Locus tag: SUB1690
Name: yjdR
Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
Locus tag: SUB1689
Name: ydaG
Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: SUB1688
Name: ydbA
Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
yjdR
Predicted multidrug resistance transcriptional regulator, MarR family
ydaG
Predicted ABC multidrug transporter, ATP-binding and permease protein
ydbA
Predicted ABC multidrug transporter, ATP-binding and permease protein

Position: -87
Score: 6
Sequence: ATAGTTCTCAGGGTAACTAT
Locus tag: SUB1642
Name: yjdE
Funciton: Predicted drug resistance transporter, EmrB/QacA family
Locus tag: SUB1643
Name: yjdF
Funciton: Conserved hypothetical protein
yjdE
Predicted drug resistance transporter, EmrB/QacA family
yjdF
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD