Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YjdR in Streptococcus gallolyticus UCN34

Properties
Regulator type: Transcription factor
TF locus tag: GALLO_1290
Regulator family: MarR
Regulation mode:
Biological process: Multidrug resistance
Effector:
Regulog: YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 6.7
Sequence: ATAGTTCTCATAAGAACTAT
Locus tag: GALLO_1290
Name: yjdR
Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
Locus tag: GALLO_1289
Name: yfiB
Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: GALLO_1288
Name: yfiC
Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
yjdR
Predicted multidrug resistance transcriptional regulator, MarR family
yfiB
Predicted ABC multidrug transporter, ATP-binding and permease protein
yfiC
Predicted ABC multidrug transporter, ATP-binding and permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD