Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YjdR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type: Transcription factor
TF locus tag: Sez_0219
Regulator family: MarR
Regulation mode:
Biological process: Multidrug resistance
Effector:
Regulog: YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -52
Score: 6.3
Sequence: ATAGTTCCCAAGAGAACTAA
Position: -31
Score: 6.1
Sequence: ATGGTTATCATGAGAACTAA
Locus tag: Sez_0219
Name: yjdR
Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
yjdR
Predicted multidrug resistance transcriptional regulator, MarR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD