Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YjdR in Streptococcus agalactiae 2603V/R

Properties
Regulator type: Transcription factor
TF locus tag: SAG1332
Regulator family: MarR
Regulation mode:
Biological process: Multidrug resistance
Effector:
Regulog: YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -35
Score: 6.4
Sequence: ATAGTTCTCACGGTAACTAT
Locus tag: SAG1332
Name: yjdR
Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
yjdR
Predicted multidrug resistance transcriptional regulator, MarR family

Position: -144
Score: 6.6
Sequence: ATAGTTCTCACGATAACTAA
Locus tag: SAG1707
Name: yjdE
Funciton: Predicted drug resistance transporter, EmrB/QacA family
Locus tag: SAG1706
Name: yjdF
Funciton: Conserved hypothetical protein
yjdE
Predicted drug resistance transporter, EmrB/QacA family
yjdF
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD