Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Streptococcus pyogenes M1 GAS

Properties
Regulator type: Transcription factor
TF locus tag: SPy1202
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 66 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -64
Score: 6.5
Sequence: AAATTGGTATATACCATATA
Position: -35
Score: 5.4
Sequence: CGAAAGGTCTATACCAATTA
Locus tag: SPy1399
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Position: -150
Score: 6.1
Sequence: TAATTAGACTATACCAATTT
Position: -72
Score: 6.2
Sequence: TAATTAGACTATACCAATTA
Locus tag: SPy1280
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)

Position: -68
Score: 6.3
Sequence: AAAGTGGTATATACCATTTA
Locus tag: SPy1694
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagA
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD