Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type: Transcription factor
TF locus tag: str0428
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Streptococcaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -26
Score: 5.8
Sequence: TTACTATATTTAAAAAGGATA
Locus tag: str0429
Name: nadR
Funciton: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
Locus tag: str0428
Name: nrtR
Funciton: NAD biosynthesis transcriptional regulator NrtR, NrtR family
nadR
Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
nrtR
NAD biosynthesis transcriptional regulator NrtR, NrtR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD