Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ScrR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type: Transcription factor
TF locus tag: PEPE_0520
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -193
Score: 6.5
Sequence: TATGTCAATCGTTTGACATT
Position: -104
Score: 6.1
Sequence: TGTATCAAACGCTTGACATA
Locus tag: PEPE_0518
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Locus tag: PEPE_0517
Name: agaB
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: PEPE_0516
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
scrA
Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
agaB
Alpha-galactosidase (EC 3.2.1.22)
scrK
Fructokinase (EC 2.7.1.4)

Position: -171
Score: 6
Sequence: TATGTCAAGCGTTTGATACA
Position: -82
Score: 6.4
Sequence: AATGTCAAACGATTGACATA
Locus tag: PEPE_0519
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: PEPE_0520
Name: scrR
Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
Locus tag: PEPE_0521
Name: agl4
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
scrB
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrR
Sucrose utilization transcriptional regulator ScrR, LacI family
agl4
Oligo-1,6-glucosidase (EC 3.2.1.10)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD