Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ScrR in Streptococcus uberis 0140J

Properties
Regulator type: Transcription factor
TF locus tag: SUB1545
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -108
Score: 6.8
Sequence: TATGTCAAGCGTTTGACATA
Locus tag: SUB1544
Name: scrB
Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Locus tag: SUB1545
Name: scrR
Funciton: Sucrose utilization regulator ScrR, LacI family
scrB
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrR
Sucrose utilization regulator ScrR, LacI family

Position: -96
Score: 6.8
Sequence: TATGTCAAACGCTTGACATA
Locus tag: SUB1543
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Locus tag: SUB1542
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
scrA
Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
scrK
Fructokinase (EC 2.7.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD