Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type: Transcription factor
TF locus tag: str1014
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -109
Score: 5.3
Sequence: TTATGAAACCGTTATCATAA
Locus tag: str1014
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
malR
Maltose utilization transcriptional regulator MalR, LacI family

Position: -57
Score: 5.6
Sequence: ACGTGCAACCGTTTGCATTA
Locus tag: str1013
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: str1012
Name: malP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malP
Maltodextrin phosphorylase (EC 2.4.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD