Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Streptococcus suis 05ZYH33

Properties
Regulator type: Transcription factor
TF locus tag: SSU05_2137
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Streptococcaceae
Statistics of regulated genes:
- Genes 14
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 5.8
Sequence: TAATGCAAACGTTTACGCTA
Position: -40
Score: 4.8
Sequence: AAAAGAAAACGGTTACGCAT
Locus tag: SSU05_0396
Name: rgfB
Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
Locus tag: SSU05_0397
Name: ptsG
Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
Locus tag: SSU05_0398
Name: ptsG
Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
rgfB
Exodeoxyribonuclease III (EC 3.1.11.2)
ptsG
PTS system glucose-specific EIICBA component (EC 2.7.1.69)
ptsG
PTS system glucose-specific EIICBA component (EC 2.7.1.69)

Position: -62
Score: 5.7
Sequence: TTAGGAAAACGTTTGCGCAA
Locus tag: SSU05_2133
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SSU05_2134
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SSU05_2135
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: SSU05_2136
Name: malA
Funciton: Maltodextrose utilization protein MalA
Locus tag: SSU05_2137
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
Locus tag: SSU05_2138
Name: pulA2
Funciton: Pullulanase (EC 3.2.1.41)
malX
Maltose/maltodextrin ABC transporter, substrate-binding protein
malC
Maltose/maltodextrin ABC transporter, permease protein 1
malD
Maltose/maltodextrin ABC transporter, permease protein 2
malA
Maltodextrose utilization protein MalA
malR
Maltose utilization transcriptional regulator MalR, LacI family
pulA2
Pullulanase (EC 3.2.1.41)

Position: -260
Score: 5.4
Sequence: TTGCGCAAACGTTTTCCTAA
Position: -46
Score: 5.1
Sequence: AAGAGAAAACGTTTGCGTTG
Locus tag: SSU05_2132
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: SSU05_2131
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)

Position: -57
Score: 6.2
Sequence: AAGTGCAAACGTTTGCGTTA
Locus tag: SSU05_0392
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: SSU05_0393
Name: null
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: SSU05_0394
Name: malP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malP
Maltodextrin phosphorylase (EC 2.4.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD