Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Streptococcus sanguinis SK36

Properties
Regulator type: Transcription factor
TF locus tag: SSA_2267
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Streptococcaceae
Statistics of regulated genes:
- Genes 11
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -204
Score: 5.3
Sequence: AACAGAAAACGTTTGCGTTT
Locus tag: SSA_2267
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
Locus tag: SSA_2268
Name: pulA2
Funciton: Pullulanase (EC 3.2.1.41)
malR
Maltose utilization transcriptional regulator MalR, LacI family
pulA2
Pullulanase (EC 3.2.1.41)

Position: -58
Score: 5.2
Sequence: TACAGAAAACGTTTGCATAG
Locus tag: SSA_0453
Name: pulA
Funciton: Pullulanase (EC 3.2.1.41)
pulA
Pullulanase (EC 3.2.1.41)

Position: -58
Score: 5.1
Sequence: AGACGCAAACGATTGCGCCT
Locus tag: SSA_1024
Name: amyA2
Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1)
amyA2
Cytoplasmic alpha-amylase (EC 3.2.1.1)

Position: -251
Score: 4.9
Sequence: AAACGCAAACGTTTTCTGTT
Position: -64
Score: 6
Sequence: CGACGCAAACGTTTGCATTA
Locus tag: SSA_2266
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: SSA_2265
Name: malP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malP
Maltodextrin phosphorylase (EC 2.4.1.1)

Position: -195
Score: 5
Sequence: TCATGCAATCGTTTTCGTTG
Position: -56
Score: 5.5
Sequence: ACATGCAAACGATTTCACAA
Locus tag: SSA_1809
Name: ptsG
Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
Locus tag: SSA_1808
Name: rgfB
Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
ptsG
PTS system glucose-specific EIICBA component (EC 2.7.1.69)
rgfB
Exodeoxyribonuclease III (EC 3.1.11.2)

Position: -56
Score: 6
Sequence: AATTGCAAACGGTTGCATAA
Locus tag: SSA_1298
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SSA_1299
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SSA_1300
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
Maltose/maltodextrin ABC transporter, permease protein 1
malG
Maltose/maltodextrin ABC transporter, permease protein 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD