Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Streptococcus pyogenes M1 GAS

Properties
Regulator type: Transcription factor
TF locus tag: SPy1293
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Streptococcaceae
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 5.8
Sequence: TTGCGCAAACGATTGCACAA
Locus tag: SPy1973
Name: dexB
Funciton: Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)
dexB
Glucan 1,6-alpha-glucosidase (EC 3.2.1.70)

Position: -103
Score: 5.6
Sequence: CAATGCAAGCGATTGCATCA
Locus tag: SPy1986
Name: ptsG
Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
Locus tag: SPy1985
Name: rgfB
Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
ptsG
PTS system glucose-specific EIICBA component (EC 2.7.1.69)
rgfB
Exodeoxyribonuclease III (EC 3.1.11.2)

Position: -207
Score: 5.8
Sequence: TTATGCAACCGCTTGCAGAA
Locus tag: SPy1293
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
malR
Maltose utilization transcriptional regulator MalR, LacI family

Position: -66
Score: 5.2
Sequence: TCTTGCAAGCGCTTGCGCAA
Locus tag: SPy1972
Name: pulA
Funciton: Pullulanase (EC 3.2.1.41)
pulA
Pullulanase (EC 3.2.1.41)

Position: -58
Score: 6
Sequence: TTACGCAAGCGCTTGCGTTA
Locus tag: SPy1292
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: SPy1291
Name: malP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malP
Maltodextrin phosphorylase (EC 2.4.1.1)

Position: -58
Score: 6
Sequence: TTCTGCAAGCGGTTGCATAA
Locus tag: SPy1294
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SPy1295
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SPy1296
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
Maltose/maltodextrin ABC transporter, permease protein 1
malG
Maltose/maltodextrin ABC transporter, permease protein 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD