Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Streptococcus mutans UA159

Properties
Regulator type: Transcription factor
TF locus tag: SMU.1566
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Streptococcaceae
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -45
Score: 6.1
Sequence: AAATGCAAACGTTTGCATGA
Locus tag: SMU.2047
Name: ptsG
Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
Locus tag: SMU.2046c
Name: rgfB
Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
ptsG
PTS system glucose-specific EIICBA component (EC 2.7.1.69)
rgfB
Exodeoxyribonuclease III (EC 3.1.11.2)

Position: -200
Score: 5.8
Sequence: TTATGCAATCGTTTGCGAAA
Locus tag: SMU.1566
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
malR
Maltose utilization transcriptional regulator MalR, LacI family

Position: -61
Score: 6.4
Sequence: TTATGCAAACGATTGCGTTA
Locus tag: SMU.1565
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: SMU.1564
Name: malP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malP
Maltodextrin phosphorylase (EC 2.4.1.1)

Position: -66
Score: 6
Sequence: TTTCGCAAACGATTGCATAA
Locus tag: SMU.1568
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SMU.1569
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SMU.1570
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
Maltose/maltodextrin ABC transporter, permease protein 1
malG
Maltose/maltodextrin ABC transporter, permease protein 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD