Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type: Transcription factor
TF locus tag: SGO_0100
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Streptococcaceae
Statistics of regulated genes:
- Genes 11
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -52
Score: 5.7
Sequence: TTATGAAAACGTTTGCTTTA
Locus tag: SGO_1351
Name: nepU
Funciton: Neopullulanase (EC 3.2.1.135)
nepU
Neopullulanase (EC 3.2.1.135)

Position: -105
Score: 5.2
Sequence: CGACGCAAACGTTTGCGTCC
Locus tag: SGO_1075
Name: amyA2
Funciton: Cytoplasmic alpha-amylase (EC 3.2.1.1)
amyA2
Cytoplasmic alpha-amylase (EC 3.2.1.1)

Position: -280
Score: 5.5
Sequence: CAACGAAAACGTTTGCGTAG
Position: -66
Score: 6
Sequence: TTAAGAAAACGTTTGCGTAA
Locus tag: SGO_0104
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SGO_0103
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SGO_0102
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: SGO_0101
Name: malA
Funciton: Maltodextrose utilization protein MalA
Locus tag: SGO_0100
Name: malR
Funciton: Maltose utilization transcriptional regulator MalR, LacI family
malX
Maltose/maltodextrin ABC transporter, substrate-binding protein
malC
Maltose/maltodextrin ABC transporter, permease protein 1
malD
Maltose/maltodextrin ABC transporter, permease protein 2
malA
Maltodextrose utilization protein MalA
malR
Maltose utilization transcriptional regulator MalR, LacI family

Position: -278
Score: 5.7
Sequence: TTACGCAAACGTTTTCTTAA
Position: -64
Score: 5.4
Sequence: CTACGCAAACGTTTTCGTTG
Locus tag: SGO_0105
Name: malM
Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Locus tag: SGO_0106
Name: malP
Funciton: Maltodextrin phosphorylase (EC 2.4.1.1)
malM
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
malP
Maltodextrin phosphorylase (EC 2.4.1.1)

Position: -290
Score: 5.3
Sequence: TCACGCAATCGTTTGCTTAA
Position: -49
Score: 5.6
Sequence: CAATGCAAACGATTTCATAT
Locus tag: SGO_0505
Name: ptsG
Funciton: PTS system glucose-specific EIICBA component (EC 2.7.1.69)
Locus tag: SGO_0506
Name: rgfB
Funciton: Exodeoxyribonuclease III (EC 3.1.11.2)
ptsG
PTS system glucose-specific EIICBA component (EC 2.7.1.69)
rgfB
Exodeoxyribonuclease III (EC 3.1.11.2)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD