Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type: Transcription factor
TF locus tag: L0144
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 80 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -187
Score: 5.5
Sequence: TGTCGCAAACGGTTGCGTCA
Locus tag: L128694
Name: nepU
Funciton: Neopullulanase (EC 3.2.1.135)
nepU
Neopullulanase (EC 3.2.1.135)

Position: -68
Score: 5.6
Sequence: AAAAGCAAACGGTTGTGTAA
Locus tag: L128695
Name: malE
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: L128696
Name: malF
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: L128697
Name: malG
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
malE
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
Maltose/maltodextrin ABC transporter, permease protein 1
malG
Maltose/maltodextrin ABC transporter, permease protein 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD