Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CopR in Streptococcus uberis 0140J

Properties
Regulator type: Transcription factor
TF locus tag: SUB1464
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 39 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -66
Score: 5.9
Sequence: ATATTTACAATTGTAGATAT
Position: -34
Score: 6.1
Sequence: ATATTTACAAATGTAAACAA
Locus tag: SUB1464
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
Locus tag: SUB1463
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SUB1462
Name: copZ
Funciton: Copper chaperone
copR
Copper transport transcriptional regulator CopR, CopY family
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
copZ
Copper chaperone
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD