Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CopR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type: Transcription factor
TF locus tag: LACR_0889
Regulator family: CopY
Regulation mode: repressor
Biological process: Copper homeostasis
Effector: Copper ion, (Cu2+)
Regulog: CopR - Streptococcaceae
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 39 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -65
Score: 5.6
Sequence: AGGTTTACAATCGTAAACTT
Locus tag: LACR_0920
Name: copB
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copB
Copper-translocating P-type ATPase (EC 3.6.3.4)

Position: -54
Score: 6.1
Sequence: AAGTTTACAATTGTAAACTA
Locus tag: LACR_0891
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)

Position: -72
Score: 6.2
Sequence: TAGTTTACAAGTGTAAATTT
Position: -45
Score: 5.6
Sequence: AAGATTACAGATGTAAACAA
Locus tag: LACR_2184
Name: cinD
Funciton: Copper-induced nitroreductase
cinD
Copper-induced nitroreductase

Position: -53
Score: 5
Sequence: GTGTTTACGCGTGTAAACTT
Locus tag: LACR_0889
Name: copR
Funciton: Copper transport transcriptional regulator CopR, CopY family
Locus tag: LACR_0890
Name: copZ
Funciton: Copper chaperone
copR
Copper transport transcriptional regulator CopR, CopY family
copZ
Copper chaperone

Position: -45
Score: 5.9
Sequence: TCGTTTACAATTGTAAACAT
Locus tag: LACR_0072
Name: yahC
Funciton: Hypothetical protein
Locus tag: LACR_0073
Name: yahD
Funciton: Copper-inducible alpha/beta serine hydrolase
Locus tag: LACR_0074
Name: yaiA
Funciton: Glyoxalase family protein
Locus tag: LACR_0075
Name: yaiB
Funciton: Hypothetical protein
yahC
Hypothetical protein
yahD
Copper-inducible alpha/beta serine hydrolase
yaiA
Glyoxalase family protein
yaiB
Hypothetical protein

Position: -106
Score: 5.8
Sequence: ATGTTTACATGTGTAAATTT
Locus tag: LACR_0427
Name: ydiD
Funciton: FMN-dependent NADH-azoreductase
ydiD
FMN-dependent NADH-azoreductase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD