Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NiaR in Streptococcus sanguinis SK36

Properties
Regulator type: Transcription factor
TF locus tag: SSA_1349
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Regulog: NiaR - Streptococcaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -33
Score: 6.5
Sequence: TACTAGTGTATATACAGATAAA
Locus tag: SSA_1348
Name: niaX
Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
niaX
Substrate-specific component NiaX of predicted niacin ECF transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD