Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NiaR in Streptococcus pneumoniae TIGR4

Properties
Regulator type: Transcription factor
TF locus tag: SP_1234
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Regulog: NiaR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -188
Score: 4.5
Sequence: TTTTACTGTAAAGACAGTTGAC
Locus tag: SP_1859
Name: pnuC
Funciton: Ribosyl nicotinamide transporter, PnuC-like
pnuC
Ribosyl nicotinamide transporter, PnuC-like

Position: 20
Score: 6.2
Sequence: TACTAGTGTATATGCAGTTAAA
Locus tag: SP_1233
Name: niaX
Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
niaX
Substrate-specific component NiaX of predicted niacin ECF transporter

Position: -134
Score: 6
Sequence: TACAATTGTCTTGACAATTGTC
Position: -122
Score: 5.7
Sequence: GACAATTGTCTTGACACTTGTT
Locus tag: SP_2016
Name: nadC
Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
nadC
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD