Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NiaR in Streptococcus mutans UA159

Properties
Regulator type: Transcription factor
TF locus tag: SMU.331
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Regulog: NiaR - Streptococcaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 6.3
Sequence: AACTAGTGTCTTGACAGATGTA
Locus tag: SMU.332
Name: niaX
Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
niaX
Substrate-specific component NiaX of predicted niacin ECF transporter

Position: -74
Score: 5
Sequence: aAtataTGTCTTgACACaTGTA
Locus tag: SMU.946
Name: pnuC
Funciton: Ribosyl nicotinamide transporter, PnuC-like
pnuC
Ribosyl nicotinamide transporter, PnuC-like
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD