Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type: Transcription factor
TF locus tag: Haur_2073, Haur_4545
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Chloroflexia
Statistics of regulated genes:
- Genes 11
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -47
Score: 5.9
Sequence: TATTGATATAATATATCAGTA
Locus tag: Haur_1311
Name: null
Funciton: Acetyltransferase
Acetyltransferase

Position: -34
Score: 6.1
Sequence: TATTGATATCAAGTATCAATA
Locus tag: Haur_3793
Name: null
Funciton: Thioredoxin reductase (EC 1.8.1.9)
Thioredoxin reductase (EC 1.8.1.9)

Position: -80
Score: 6.5
Sequence: TAATGATACTTTGTATCAATA
Locus tag: Haur_2300
Name: Haur_2300
Funciton: cold-shock DNA-binding domain protein
Haur_2300
cold-shock DNA-binding domain protein

Position: -82
Score: 6.5
Sequence: TAATGATACATTATATCAATA
Position: -20
Score: 6.3
Sequence: TAATGATATATAGTATCAATA
Locus tag: Haur_4472
Name: Rcas_3893
Funciton: hypothetical protein
Rcas_3893
hypothetical protein

Position: -54
Score: 6.6
Sequence: TATTGATATATTGTATCAATA
Locus tag: Haur_2062
Name: yciC3
Funciton: Putative metal chaperone involved in Zn homeostasis, COG0523 family
yciC3
Putative metal chaperone involved in Zn homeostasis, COG0523 family

Position: -286
Score: 6.5
Sequence: TAATGATATATTGTATCAATA
Locus tag: Haur_2074
Name: yciC2
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: Haur_2073
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
yciC2
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -42
Score: 6.3
Sequence: TAATGATATATAGTATCAATA
Locus tag: Haur_0639
Name: yciC
Funciton: Putative metal chaperone involved in Zn homeostasis, COG0523 family
yciC
Putative metal chaperone involved in Zn homeostasis, COG0523 family

Position: -95
Score: 6.2
Sequence: TAATGATACAAAATATCATTA
Locus tag: Haur_2064
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Haur_2065
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Haur_2066
Name: znuB
Funciton: Zinc ABC transporter, permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD