Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Chloroflexus aggregans DSM 9485

Properties
Regulator type: Transcription factor
TF locus tag: Cagg_2024, Cagg_1460
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Chloroflexia
Statistics of regulated genes:
- Genes 8
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -52
Score: 5.5
Sequence: AAATGATATATTATCTCAATA
Locus tag: Cagg_0322
Name: fmdB
Funciton: putative regulatory protein, FmdB family
Locus tag: Cagg_0321
Name: yciC2
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
fmdB
putative regulatory protein, FmdB family
yciC2
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -2
Score: 5.8
Sequence: TAATGATCCATAGTATCATTA
Locus tag: Cagg_2024
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -74
Score: 5.8
Sequence: TATTGACACACTGTATCAATA
Locus tag: Cagg_2028
Name: COG0701
Funciton: predicted permease
COG0701
predicted permease

Position: -79
Score: 5.8
Sequence: TAATGATATAACGTATCATTT
Position: -20
Score: 4.5
Sequence: AATCGAGATAAGGTATCAATG
Locus tag: Cagg_0608
Name: yciC
Funciton: Putative metal chaperone involved in Zn homeostasis, COG0523 family
yciC
Putative metal chaperone involved in Zn homeostasis, COG0523 family

Position: -35
Score: 5.9
Sequence: AATTGAAACATAGTTTCATTA
Locus tag: Cagg_2043
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Cagg_2044
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Cagg_2045
Name: znuB
Funciton: Zinc ABC transporter, permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD