Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Roseiflexus sp. RS-1

Properties
Regulator type: Transcription factor
TF locus tag: RoseRS_3462
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Chloroflexia
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -148
Score: 6.4
Sequence: CTGGCACTCTTCCCTTTTGAGTGCTAA
Position: -75
Score: 7.8
Sequence: TTAGCACTCTTCCGTCGAGAGTGCTAA
Locus tag: RoseRS_4130
Name: groES
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: RoseRS_4131
Name: groEL
Funciton: Heat shock protein 60 family chaperone GroEL
groES
Heat shock protein 60 family co-chaperone GroES
groEL
Heat shock protein 60 family chaperone GroEL

Position: -190
Score: 7.1
Sequence: CTAGCACTCAATAGTCGAGAGTGCTAA
Locus tag: RoseRS_3462
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: RoseRS_3461
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: RoseRS_3460
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: RoseRS_3459
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat-inducible transcription repressor HrcA
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD