Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GamR in Oceanobacillus iheyensis HTE831

Properties
Regulator type: Transcription factor
TF locus tag: OB2272
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Regulog: GamR - Bacillales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -81
Score: 5.8
Sequence: AAATTTGTTATAACACAATT
Locus tag: OB2272
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: OB2271
Name: null
Funciton: Predicted chitooligosaccharide deacetylase
gamR
Predicted transcriptional regulator of glucosamine utilization, GntR family
Predicted chitooligosaccharide deacetylase

Position: -126
Score: 5.8
Sequence: AATTGTGTTATAACAAATTT
Locus tag: OB2273
Name: licH
Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: OB2274
Name: ywbA
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: OB2275
Name: ywbB
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: OB2276
Name: ywbC
Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
licH
Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
ywbA
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
ywbB
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
ywbC
PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD