Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GamR in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type: Transcription factor
TF locus tag: BSU02370
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Regulog: GamR - Bacillales
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 5
Sequence: AAATTCGTAATGACAAGTAT
Position: -52
Score: 5.9
Sequence: AAATTGGTCATAACAAATAT
Locus tag: BSU02360
Name: gamA
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Locus tag: BSU02350
Name: gamP
Funciton: PTS system, Glucosamine-specific IIB component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIC component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIA component (EC 2.7.1.69)
gamA
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
gamP
PTS system, Glucosamine-specific IIB component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIC component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIA component (EC 2.7.1.69)

Position: -186
Score: 5.9
Sequence: ATATTTGTTATGACCAATTT
Position: -163
Score: 5
Sequence: ATACTTGTCATTACGAATTT
Locus tag: BSU02370
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
gamR
Predicted transcriptional regulator of glucosamine utilization, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD