Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GamR in Bacillus licheniformis DSM 13

Properties
Regulator type: Transcription factor
TF locus tag: BLi00336
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Regulog: GamR - Bacillales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -300
Score: 6.2
Sequence: AAATTTGTCATAACAAATTT
Locus tag: BLi00338
Name: chiA
Funciton: Chitinase (EC 3.2.1.14)
chiA
Chitinase (EC 3.2.1.14)

Position: -110
Score: 5.2
Sequence: TAACATGTTATAACAAATTT
Position: -96
Score: 4.6
Sequence: AAATTTGTCCATACATATTT
Position: -82
Score: 6.2
Sequence: ATATTTGTTATAACAAATTG
Locus tag: BLi00336
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: BLi00337
Name: null
Funciton: Predicted chitooligosaccharide deacetylase
gamR
Predicted transcriptional regulator of glucosamine utilization, GntR family
Predicted chitooligosaccharide deacetylase

Position: -99
Score: 6.2
Sequence: CAATTTGTTATAACAAATAT
Position: -85
Score: 4.6
Sequence: AAATATGTATGGACAAATTT
Position: -71
Score: 5.2
Sequence: AAATTTGTTATAACATGTTA
Locus tag: BLi00335
Name: licH
Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: BLi00334
Name: ywbA
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: BLi00333
Name: ywbB
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: BLi00332
Name: ywbC
Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
licH
Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
ywbA
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
ywbB
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
ywbC
PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD