Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GamR in Bacillus halodurans C-125

Properties
Regulator type: Transcription factor
TF locus tag: BH0914
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Regulog: GamR - Bacillales
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -92
Score: 5.6
Sequence: ATATTTGTTATTACATTTAT
Position: -68
Score: 4.7
Sequence: ATTTTAGTAGTAACTTTTAT
Position: -44
Score: 5.2
Sequence: AATATTGTTACTACAAATAA
Locus tag: BH0916
Name: chiA
Funciton: Chitinase (EC 3.2.1.14)
chiA
Chitinase (EC 3.2.1.14)

Position: -74
Score: 5.6
Sequence: TGATTAGTAGTAACAAATAT
Locus tag: BH0912
Name: licH
Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: BH0911
Name: ywbA
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: BH0910
Name: ywbB
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: BH0909
Name: ywbC
Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)
licH
Cytoplasmic 6-phospho-beta-glucosidase (EC 3.2.1.86)
ywbA
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC 2.7.1.69)
ywbB
PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC 2.7.1.69)
ywbC
PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC 2.7.1.69)

Position: -116
Score: 5.6
Sequence: ATATTTGTTACTACTAATCA
Position: -92
Score: 4.8
Sequence: TTAATTGTAGTTACTTATTT
Position: -60
Score: 4.6
Sequence: TTATACGTAATGACAATTTT
Locus tag: BH0913
Name: BH0913
Funciton: Predicted chitooligosaccharide deacetylase
BH0913
Predicted chitooligosaccharide deacetylase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD