Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PhnR in Salmonella typhimurium LT2

Properties
Regulator type: Transcription factor
TF locus tag: STM0430
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Regulog: PhnR - Enterobacteriales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 6
Sequence: AACCTGGTATAGGCCAGAAA
Locus tag: STM0429
Name: phnS
Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: STM0428
Name: phnT
Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: STM0427
Name: phnU
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: STM0426
Name: phnV
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnS
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
phnT
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
phnU
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnV
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)

Position: -131
Score: 5.3
Sequence: CCTTTGGTCTATACCAGATT
Locus tag: STM0430
Name: phnR
Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
phnR
2-aminoethylphosphonate utilization regulator, GntR family

Position: -28
Score: 6.2
Sequence: AATCTGGTATAGACCAAAGG
Locus tag: STM0431
Name: phnW
Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
Locus tag: STM0432
Name: phnX
Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
phnW
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
phnX
Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD