Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PhnF in Methylibium petroleiphilum PM1

Properties
Regulator type: Transcription factor
TF locus tag: Mpe_B0420, Mpe_B0456
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization
Effector:
Regulog: PhnF - Comamonadaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -28
Score: 4.4
Sequence: CCCAGATATCTAGACATCTGGA
Locus tag: Mpe_B0456
Name: phnF
Funciton: phophonate C-P lyase system transcriptional regulator PhnF, GntR family
Locus tag: Mpe_B0457
Name: phnD
Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
Locus tag: Mpe_B0458
Name: phnC
Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
phnF
phophonate C-P lyase system transcriptional regulator PhnF, GntR family
phnD
Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
phnC
Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)

Position: -28
Score: 4.4
Sequence: CCCAGATATCTAGACATCTGGA
Locus tag: Mpe_B0420
Name: phnF
Funciton: phophonate C-P lyase system transcriptional regulator PhnF, GntR family
Locus tag: Mpe_B0421
Name: phnD
Funciton: Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
Locus tag: Mpe_B0422
Name: phnC
Funciton: Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
phnF
phophonate C-P lyase system transcriptional regulator PhnF, GntR family
phnD
Phosphonate ABC transporter phosphate-binding periplasmic component (TC 3.A.1.9.1)
phnC
Phosphonate ABC transporter ATP-binding protein (TC 3.A.1.9.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD