Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RutR in Acinetobacter baumannii AB0057

Properties
Regulator type: Transcription factor
TF locus tag: AB57_0065
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Regulog: RutR - Moraxellaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -116
Score: 5.3
Sequence: ATTATACCGATCGTTAAAAA
Locus tag: AB57_3907
Name: rutG2
Funciton: Uracil permease
rutG2
Uracil permease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD