Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PsrA in Laribacter hongkongensis HLHK9

Properties
Regulator type: Transcription factor
TF locus tag: LHK_01607
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Various betaproteobacteria
Statistics of regulated genes:
- Genes 16
- Operons 12
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -187
Score: 6.1
Sequence: ATTCAAACGACTGTTTGAAG
Locus tag: LHK_02913
Name: etfB
Funciton: Electron transfer flavoprotein, beta subunit
Locus tag: LHK_02912
Name: etfA
Funciton: Electron transfer flavoprotein, alpha subunit
Locus tag: LHK_02910
Name: acdH2
Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3)
etfB
Electron transfer flavoprotein, beta subunit
etfA
Electron transfer flavoprotein, alpha subunit
acdH2
Acyl-CoA dehydrogenase (EC 1.3.99.3)

Position: -88
Score: 5.8
Sequence: GTTCAAACGATCGTTTTATT
Locus tag: LHK_02384
Name: null
Funciton: probable acyl-CoA-binding protein
probable acyl-CoA-binding protein

Position: -54
Score: 6
Sequence: ATCCAAACATTCGTTTGAAA
Position: -21
Score: 5.5
Sequence: TTTCAAACGGTCGTTTAACC
Locus tag: LHK_02264
Name: acdH
Funciton: Probable acyl-CoA dehydrogenase
acdH
Probable acyl-CoA dehydrogenase

Position: -90
Score: 5.4
Sequence: AGGCAAACGCCCGTTTGACA
Locus tag: LHK_00568
Name: fabF
Funciton: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
fabF
3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)

Position: -40
Score: 5.8
Sequence: TATCAAACACTCGTTTGATA
Locus tag: LHK_02406
Name: scp
Funciton: SCP-2 sterol transfer family
scp
SCP-2 sterol transfer family

Position: 43
Score: 6
Sequence: AATCAAACGGTCGTTTGACA
Locus tag: LHK_00049
Name: fadH
Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
fadH
2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)

Position: -68
Score: 5.9
Sequence: ATTCAAACAGTCGTTTGATG
Locus tag: LHK_00066
Name: null
Funciton: Putative enoyl-CoA hydratase
Putative enoyl-CoA hydratase

Position: -107
Score: 5.6
Sequence: AATCAAACGACCGTTTGGCT
Locus tag: LHK_01931
Name: fadD
Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
fadD
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)

Position: -22
Score: 5.6
Sequence: TTTCAAACGATCGTTTGCTT
Locus tag: LHK_02202
Name: null
Funciton: hypothetical protein
hypothetical protein

Position: -142
Score: 5.6
Sequence: TATAAAACGGCTGTTTGAAA
Position: -63
Score: 4.9
Sequence: TCTCAAACGATCGTTTGCCT
Locus tag: LHK_01608
Name: fadL
Funciton: Long-chain fatty acid transport protein
Locus tag: LHK_01609
Name: acdB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
Locus tag: LHK_01610
Name: acdA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadL
Long-chain fatty acid transport protein
acdB
Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
acdA
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)

Position: -38
Score: 5.4
Sequence: ATTAAAACGTAAGTTTCAAA
Position: -25
Score: 5.6
Sequence: TTTCAAACAACTGTTTGGAT
Locus tag: LHK_01607
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
psrA
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family

Position: -97
Score: 5.9
Sequence: ATTCAAACGGCCGTTTGACG
Locus tag: LHK_02892
Name: etfD
Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
etfD
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD