Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PsrA in Chromobacterium violaceum ATCC 12472

Properties
Regulator type: Transcription factor
TF locus tag: CV2724
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Various betaproteobacteria
Statistics of regulated genes:
- Genes 16
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -106
Score: 5.7
Sequence: ATTTAAACAAACGTTTGAAC
Locus tag: CV1785
Name: acdH
Funciton: Probable acyl-CoA dehydrogenase
acdH
Probable acyl-CoA dehydrogenase

Position: -101
Score: 5.9
Sequence: AACCAAACGCTCGTTTGAAT
Locus tag: CV3818
Name: etfB
Funciton: Electron transfer flavoprotein, beta subunit
Locus tag: CV3817
Name: etfA
Funciton: Electron transfer flavoprotein, alpha subunit
Locus tag: CV3816
Name: acdH2
Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3)
etfB
Electron transfer flavoprotein, beta subunit
etfA
Electron transfer flavoprotein, alpha subunit
acdH2
Acyl-CoA dehydrogenase (EC 1.3.99.3)

Position: -91
Score: 5.6
Sequence: TTCCAAACGCGCGTTTGAAC
Locus tag: CV3412
Name: fabF
Funciton: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
fabF
3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)

Position: -78
Score: 6
Sequence: ATTAAAACATTCGTTTGAAA
Locus tag: CV2194
Name: fabK
Funciton: Enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9)
fabK
Enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9)

Position: -18
Score: 5.2
Sequence: ATTAAAACCATCGTTTGCAT
Locus tag: CV4051
Name: fadD
Funciton: Probable long chain fatty-acid CoA ligase
fadD
Probable long chain fatty-acid CoA ligase

Position: -24
Score: 6.1
Sequence: ATCCAAACGACCGTTTGAAT
Locus tag: CV3350
Name: null
Funciton: hypothetical protein
hypothetical protein

Position: -137
Score: 4.7
Sequence: GATCAAACCGCGGTTTGATC
Locus tag: CV1459
Name: fadD
Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
fadD
Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)

Position: -257
Score: 5.1
Sequence: ATAAAAGCGAGTGTTTGATA
Locus tag: CV2720
Name: acdB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
Locus tag: CV2719
Name: acdA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
acdB
Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
acdA
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)

Position: -136
Score: 4.8
Sequence: CATTAAACGAACGTTTGGAA
Position: -84
Score: 5.6
Sequence: GTTAAAACGTAAGTTTGAAA
Position: -71
Score: 5.3
Sequence: TTTGAAACGCTTGTTCGAAA
Locus tag: CV2724
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: CV2723
Name: fadE
Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Locus tag: CV2722
Name: null
Funciton: Acyl-CoA hydrolase (EC 3.1.2.20)
Locus tag: CV2721
Name: fadL
Funciton: Long-chain fatty acid transport protein
psrA
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Acyl-CoA hydrolase (EC 3.1.2.20)
fadL
Long-chain fatty acid transport protein

Position: -108
Score: 5.7
Sequence: GTTTAAACGCTTGTTTGATT
Locus tag: CV3916
Name: etfD
Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
etfD
Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD