Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PsrA in Thauera sp. MZ1T

Properties
Regulator type: Transcription factor
TF locus tag: Tmz1t_0804
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Regulog: PsrA - Various betaproteobacteria
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 4.7
Sequence: AAGAAAACGTATGATTCAAA
Position: -21
Score: 6.2
Sequence: ATTCAAACAAACGTTTGAAA
Locus tag: Tmz1t_0804
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: Tmz1t_0805
Name: fadE
Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Locus tag: Tmz1t_0806
Name: fadA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Locus tag: Tmz1t_0807
Name: fadB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
Locus tag: Tmz1t_0808
Name: fadL
Funciton: Long-chain fatty acid transport protein
Locus tag: Tmz1t_0809
Name: acdB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
Locus tag: Tmz1t_0810
Name: acdA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
psrA
Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
fadE
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
fadA
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
fadB
Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadL
Long-chain fatty acid transport protein
acdB
Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
acdA
3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD